version
PlantPromoterDB promoter information of AT1G58210

Summary of Gene (AT1G58210)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G58210  TAIR      NCBI 
Gene model AT1G58210  
Description EMBRYO DEFECTIVE 1674 (EMB1674); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: leaf whorl, petal, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: SANT associated (InterPro:IPR015216), KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT1G09720.1); Has 24624 Blast hits to 15362 proteins in 900 species: Archae - 370; Bacteria - 1847; Metazoa - 13466; Fungi - 2008; Plants - 1045; Viruses - 70; Other Eukaryotes - 5818 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 21552621-21553820)

Genome position     
from initiation codon
AT1G58210.1         
TSS from cDNA
TSS information
AT1G58210                        5'->3' (+)
Promoter sequence












 
AT1G58200.1         
AT1G58200.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence












 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G58210

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2+21553577-44

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTGGCGT+2155328221553289-339-332
 AtREG508CGTGGCGT PPDB Motif  PLACE MotifGCCAC 
REGAAATGGGCCCATCGTTAGGCCCATTC+2155331521553340-306-281
 AtREG386AAATGGGC                   PPDB MotifGCCCA  PLACE Motif 
 AtREG361 AATGGGCC        GGCCCATT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG391  ATGGGCCCAT               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422   TGGGCCCA                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG403     GGCCCATC              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG535             GTTAGGCC      PPDB Motif  PLACE Motif 
 AtREG360              TTAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358               TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354                AGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG643                  GCCCATTC PPDB MotifGCCCA  PLACE Motif 
REGGGCTTTTT+2155338121553388-240-233
 AtREG589GGCTTTTT PPDB Motif  PLACE Motif 
REGAGCCCATATA+2155339521553404-226-217
 AtREG477AGCCCATA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG432 GCCCATAT  PPDB MotifGCCCA  PLACE Motif 
 AtREG620  CCCATATA PPDB MotifGCCCA  PLACE Motif 
REGAATTGGGCCTGG+2155342721553438-194-183
 AtREG418AATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG352 ATTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG370   TGGGCCTG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG619    GGGCCTGG PPDB MotifGCCCA  PLACE MotifGGGCC 
REGGGCCTTAC+2155344421553451-177-170
 AtREG530GGCCTTAC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG2-21553123AT1G58200.1, AT1G58200.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCACGTGGAA-2155325621553264AT1G58200.1, AT1G58200.2
 AtREG408CACGTGGA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG627 ACGTGGAA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGACGCCACG-2155328221553289AT1G58200.1, AT1G58200.2
 AtREG508ACGCCACG PPDB Motif  PLACE MotifGCCAC 
REGGAATGGGCCTAACGATGGGCCCATTT-2155331521553340AT1G58200.1, AT1G58200.2
 AtREG643GAATGGGC                   PPDB MotifGCCCA  PLACE Motif 
 AtREG361 AATGGGCC        GGCCCATT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  ATGGGCCT                 PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358   TGGGCCTA                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360    GGGCCTAA               PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG535     GGCCTAAC              PPDB Motif  PLACE Motif 
 AtREG403             GATGGGCC      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG391              ATGGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422               TGGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG386                  GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGAAAAAGCC-2155338121553388AT1G58200.1, AT1G58200.2
 AtREG589AAAAAGCC PPDB Motif  PLACE Motif 
REGTATATGGGCT-2155339521553404AT1G58200.1, AT1G58200.2
 AtREG620TATATGGG   PPDB MotifGCCCA  PLACE Motif 
 AtREG432 ATATGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG477  TATGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.