version
PlantPromoterDB promoter information of AT1G62880.2

Summary of Gene (AT1G62880.2)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G62880  TAIR      NCBI 
Gene model AT1G62880.2  
Description cornichon family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular signaling cascade; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cornichon (InterPro:IPR003377); BEST Arabidopsis thaliana protein match is: cornichon family protein (TAIR:AT1G12390.1); Has 465 Blast hits to 465 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 110; Plants - 43; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 23291125-23292324)

Genome position     
from initiation codon
AT1G62880.1         
TSS from cDNA
TSS information
AT1G62880.2                      5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G62880.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4+23291941-184

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+23291931-194

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCTTCTTC+2329192723291937-198-188
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAATTGGGCTTA+2329179923291810-326-315
 AtREG600TAATTGGG     PPDB MotifGCCCA  PLACE Motif 
 AtREG418 AATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   TTGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426    TGGGCTTA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCCCATGGGCTTA+2329181923291830-306-295
 AtREG591CCCATGGG     PPDB MotifGCCCA, CCATGG  PLACE Motif 
 AtREG507 CCATGGGC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 AtREG378   ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426    TGGGCTTA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCGGTTCAA+2329188523291892-240-233
 AtREG640CGGTTCAA PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.