version
PlantPromoterDB promoter information of AT1G67960.1

Summary of Gene (AT1G67960.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G67960  TAIR      NCBI 
Gene model AT1G67960.1  
Description EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Membrane protein,Tapt1/CMV receptor (InterPro:IPR008010); Has 243 Blast hits to 229 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 79; Fungi - 87; Plants - 18; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 25485176-25483977)

Genome position     
from initiation codon
AT1G67970.1         
TSS from cDNA
TSS information
AT1G67960.1                      5'->3' (-)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G67960.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-25484261-85
TSS clone peakTclone-25484196-20

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTCTC-2548420925484216-33-40
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAGCGTTTTG-2548431325484322-137-146
 AtREG626CAGCGTTT   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG585  GCGTTTTG PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
REGACGCCGTTT-2548432925484337-153-161
 AtREG497ACGCCGTT  PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
 AtREG524 CGCCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGTAATTGGG-2548439325484400-217-224
 AtREG600TAATTGGG PPDB MotifGCCCA  PLACE Motif 
REGAACACGTGGCAG-2548440525484416-229-240
 AtREG590AACACGTG    ABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG382 ACACGTGG   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG367  CACGTGGC  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG379   ACGTGGCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG468    CGTGGCAGABA PPDB Motif  PLACE MotifGCCAC 
REGGGCTTTTT-2548442025484427-244-251
 AtREG589GGCTTTTT PPDB Motif  PLACE Motif 
REGCTAAACCGAACCGAACCGACT-2548447225484492-296-316
 AtREG511CTAAACCG              PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA             PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556   AACCGAACCGAAC      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451    ACCGAACCGAACC     PPDB Motif  PLACE Motif 
 AtREG456     CCGAACCGAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG575      CGAACCGAACCGA   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG641             AACCGACT PPDB MotifAACCG(G/A), CCGAC  PLACE MotifCCGAC, RCCGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.