version
PlantPromoterDB promoter information of AT1G68790.1

Summary of Gene (AT1G68790.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G68790  TAIR      NCBI 
Gene model AT1G68790.1  
Description LITTLE NUCLEI3 (LINC3); INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: LINC2 (LITTLE NUCLEI2) (TAIR:AT1G13220.2); Has 250284 Blast hits to 107694 proteins in 2507 species: Archae - 2115; Bacteria - 37052; Metazoa - 113182; Fungi - 17848; Plants - 9025; Viruses - 1093; Other Eukaryotes - 69969 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 25840157-25838958)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G68790.1                      5'->3' (-)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G68790.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4-25839348-191

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-25839361-204
TSS cloneAclone-25839319-162

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAAGCCCAATAGGCCCAATAA-2583941025839430-253-273
 AtREG476GAAGCCCA              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402  AGCCCAAT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355   GCCCAATA GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG624    CCCAATAG          PPDB MotifGCCCA  PLACE Motif 
 AtREG424       AATAGGCC       PPDB Motif  PLACE Motif 
 AtREG362        ATAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358         TAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356          AGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352           GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG417             CCCAATAA PPDB MotifGCCCA  PLACE Motif 
REGGAAGCCCAAAA-2583946025839470-303-313
 AtREG476GAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469  AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG529   GCCCAAAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.