version
PlantPromoterDB promoter information of AT1G70700

Summary of Gene (AT1G70700)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G70700  TAIR      NCBI 
Gene model AT1G70700  
Description JAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2.  
#
#

Overview

Focused view (chromosome 1: 26653951-26655150)

Genome position     
from initiation codon
AT1G70700.1         
AT1G70700.2         
TSS from cDNA
TSS information
AT1G70700                        5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G70700

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4+26654782-169

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+26654782-169
TSS cloneAclone+26654783-168
TSS cloneAclone+26654792-159
TSS cloneTclone+26654799-152
TSS cloneAclone+26654806-145

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAACACGTGTGA+2665466426654674-287-277
 AtREG590AACACGTG   ABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG460  CACGTGTG ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG588   ACGTGTGAABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGTTAACCGGTTTAA+2665467626654688-275-263
 AtREG501TTAACCGG      PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG503 TAACCGGT     PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG436   ACCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412    CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473     CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAAAAGCCC+2665472026654728-231-223
 AtREG589AAAAAGCC  PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.