version
PlantPromoterDB promoter information of AT1G73980.1

Summary of Gene (AT1G73980.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G73980  TAIR      NCBI 
Gene model AT1G73980.1  
Description phosphoribulokinase/uridine kinase family protein; FUNCTIONS IN: adenylate cyclase activity, phosphotransferase activity, alcohol group as acceptor, kinase activity, ATP binding; INVOLVED IN: biosynthetic process, cAMP biosynthetic process, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Uridine kinase (InterPro:IPR000764), Adenylate cyclase (InterPro:IPR008172); BEST Arabidopsis thaliana protein match is: phosphoribulokinase/uridine kinase family protein (TAIR:AT1G26190.1); Has 2533 Blast hits to 2522 proteins in 907 species: Archae - 19; Bacteria - 1635; Metazoa - 298; Fungi - 83; Plants - 169; Viruses - 2; Other Eukaryotes - 327 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 27824527-27823328)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G73980.1                      5'->3' (-)
Promoter sequence




 
AT1G73990.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G73980.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5-27824060-533

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-27824036-509

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTTCCTCCTTC-2782407327824086-546-559
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCGGTTCGGT-2782420327824212-676-685
 AtREG575TCGGTTCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456 CGGTTCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451  GGTTCGGT PPDB Motif  PLACE Motif 
REGGTTCGGTT-2782428127824288-754-761
 AtREG556GTTCGGTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCGGTTT-2782429027824297-763-770
 AtREG568TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGACGTGGAC-2782432827824335-801-808
 AtREG513ACGTGGACABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGGTGACGTGTGA-2782435027824360-823-833
 AtREG466GTGACGTG   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG517 TGACGTGT  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG588   ACGTGTGAABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA8+27824432AT1G73990.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTTCTTCTTC+2782439727824410AT1G73990.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACCGAACCGA+2782420327824212AT1G73990.1
 AtREG451ACCGAACC   PPDB Motif  PLACE Motif 
 AtREG456 CCGAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG575  CGAACCGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAACCGAAC+2782428127824288AT1G73990.1
 AtREG556AACCGAAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAACCGAA+2782429027824297AT1G73990.1
 AtREG568AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTCCACGT+2782432827824335AT1G73990.1
 AtREG513GTCCACGTABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGTCACACGTCAC+2782435027824360AT1G73990.1
 AtREG588TCACACGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG517  ACACGTCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG466   CACGTCACABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGGACGACGTGGAA+2782437627824387AT1G73990.1
 AtREG526GACGACGT     PPDB MotifACGT  PLACE MotifACGT 
 AtREG465  CGACGTGG   PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG627    ACGTGGAA PPDB MotifACGT  PLACE MotifACGT, ACGTG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.