version
PlantPromoterDB promoter information of AT1G74030.1

Summary of Gene (AT1G74030.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G74030  TAIR      NCBI 
Gene model AT1G74030.1  
Description enolase, putative; FUNCTIONS IN: phosphopyruvate hydratase activity; INVOLVED IN: in 12 processes; LOCATED IN: phosphopyruvate hydratase complex, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Enolase (InterPro:IPR000941); BEST Arabidopsis thaliana protein match is: LOS2; copper ion binding / phosphopyruvate hydratase (TAIR:AT2G36530.1); Has 9513 Blast hits to 9495 proteins in 2259 species: Archae - 189; Bacteria - 3126; Metazoa - 1415; Fungi - 220; Plants - 154; Viruses - 0; Other Eukaryotes - 4409 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 27842901-27841702)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G74030.1                      5'->3' (-)
Promoter sequence









 
AT1G74040.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G74030.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA10-27841931-30

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-27841948-47
TSS cloneAclone-27841931-30

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGAACCGGTTTAA-2784205327842065-152-164
 AtREG480TGAACCGG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528 GAACCGGT     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436   ACCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412    CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473     CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCGAACCGAACCGAACCA-2784211127842128-210-227
 AtREG456CCGAACCGAACCG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG575 CGAACCGAACCGA     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556   AACCGAACCGAAC   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451    ACCGAACCGAACC  PPDB Motif  PLACE Motif 
 AtREG655          CCGAACCA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4+27842168AT1G74040.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+27842171AT1G74040.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTAAACCGGTTCA+2784205327842065AT1G74040.1
 AtREG473TTAAACCG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528    ACCGGTTC  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480     CCGGTTCA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTGGTTCGGTTCGGTTCG+2784211127842127AT1G74040.1
 AtREG655TGGTTCGG          PPDB Motif  PLACE Motif 
 AtREG451 GGTTCGGTTCGGT    PPDB Motif  PLACE Motif 
 AtREG556  GTTCGGTTCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG575    TCGGTTCGGTTCG PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456     CGGTTCGG     PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.