version
PlantPromoterDB promoter information of AT1G75560.2

Summary of Gene (AT1G75560.2)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G75560  TAIR      NCBI 
Gene model AT1G75560.2  
Description zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 28373717-28372518)

Genome position     
from initiation codon
AT1G75560.1         
AT1G75570           
AT1G75570.1         
TSS from cDNA
TSS information
AT1G75560.2                      5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G75560.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG18-28373241-524

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-28373241-524
TSS cloneGclone-28373240-523
TSS cloneTclone-28373237-520
TSS cloneAclone-28373232-515
TSS cloneGclone-28373231-514
TSS cloneAclone-28373230-513

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAAAGCCCAGCCCAAA-2837328528373301-568-584
 AtREG589AAAAAGCC          PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC         PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA        PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG454     GCCCAGCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG469         AGCCCAAA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTAAAAGCCCAT-2837332228373332-605-615
 AtREG549TAAAAGCC    PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC   PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTCAGCCCA-2837333628373343-619-626
 AtREG609TCAGCCCA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTTCCACGTG-2837341228373420-695-703
 AtREG627TTCCACGT  PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG408 TCCACGTGABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
REGTAAATGGGCTATTGGGCTTTA-2837343528373455-718-738
 AtREG443TAAATGGG              PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC             PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581   ATGGGCTA           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG584     GGGCTATT         PPDB MotifGCCCA  PLACE Motif 
 AtREG624        CTATTGGG      PPDB MotifGCCCA  PLACE Motif 
 AtREG355         TATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG402          ATTGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407           TTGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376            TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365             GGGCTTTA PPDB MotifGCCCA  PLACE Motif 
REGGACCCGGG-2837350928373516-792-799
 AtREG593GACCCGGG PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.