version
PlantPromoterDB promoter information of AT1G75570

Summary of Gene (AT1G75570)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G75570  TAIR      NCBI 
Gene model AT1G75570  
Description pre-tRNA  
#
#

Overview

Focused view (chromosome 1: 28374561-28373362)

Genome position     
AT1G75570.1         
TSS from cDNA
TSS information
AT1G75570                        5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G75570

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTCCACGTG-2837341228373420AT1G75560.1, AT1G75560.2
 AtREG627TTCCACGT  PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG408 TCCACGTGABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
REGTAAATGGGCTATTGGGCTTTA-2837343528373455AT1G75560.1, AT1G75560.2
 AtREG443TAAATGGG              PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC             PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581   ATGGGCTA           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG584     GGGCTATT         PPDB MotifGCCCA  PLACE Motif 
 AtREG624        CTATTGGG      PPDB MotifGCCCA  PLACE Motif 
 AtREG355         TATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG402          ATTGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407           TTGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376            TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365             GGGCTTTA PPDB MotifGCCCA  PLACE Motif 
REGGACCCGGG-2837350928373516AT1G75560.1, AT1G75560.2
 AtREG593GACCCGGG PPDB MotifGGGACCC  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.