version
PlantPromoterDB promoter information of AT1G77122.1

Summary of Gene (AT1G77122.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G77122  TAIR      NCBI 
Gene model AT1G77122.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0090 (InterPro:IPR003728); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69210.1); Has 5575 Blast hits to 1500 proteins in 157 species: Archae - 0; Bacteria - 130; Metazoa - 4006; Fungi - 245; Plants - 178; Viruses - 112; Other Eukaryotes - 904 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 28979674-28978475)

Genome position     
from initiation codon
AT1G77130.1         
TSS from cDNA
TSS information
AT1G77122.1                      5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G77122.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakC5-28979334-660
TSS peakA8-28978723-49

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-28978718-44
TSS cloneCclone-28978687-13

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTCTTCTTCTTC-2897868928978704-15-30
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAACCGGAACCGAACCGAACCGA-2897878628978808-112-134
 AtREG579GAACCGGA                PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 AACCGGAA               PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556       AACCGAACCGAAC    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451        ACCGAACCGAACC   PPDB Motif  PLACE Motif 
 AtREG456         CCGAACCGAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG575          CGAACCGAACCGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAAGTCAA-2897882528978832-151-158
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGCCGTTGGA-2897883728978844-163-170
 AtREG554CCGTTGGA PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
REGGGGCTTTT-2897885128978858-177-184
 AtREG409GGGCTTTT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.