version
PlantPromoterDB promoter information of AT1G77490.1

Summary of Gene (AT1G77490.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G77490  TAIR      NCBI 
Gene model AT1G77490.1  
Description Encodes a chloroplastic thylakoid ascorbate peroxidase tAPX. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms.  
#
#

Overview

Focused view (chromosome 1: 29116688-29117887)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G77490.1                      5'->3' (+)
Promoter sequence









 
AT1G77480.1         
AT1G77480.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G77490.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8+29117622-66

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+29117598-90

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCTTCTTCC+2911763829117649-50-39
Y PatchTTTCTCTCC+2911765529117663-33-25
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGCGCC+2911742329117430-265-258
 AtREG486CACGCGCC PPDB MotifACGCGC  PLACE Motif 
REGCAAAGGCCTAAC+2911744529117456-243-232
 AtREG656CAAAGGCC     PPDB Motif  PLACE Motif 
 AtREG535    GGCCTAAC PPDB Motif  PLACE Motif 
REGAGGGCCCAATAT+2911747229117483-216-205
 AtREG400AGGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392 GGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352  GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355   GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG509    CCCAATAT PPDB Motif  PLACE Motif 
REGTCGGCCCATAA+2911748629117496-202-192
 AtREG393TCGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380 CGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364  GGCCCATA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG394   GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGGGCGCGTGACGT+2911752029117531-168-157
 AtREG486GGCGCGTG     PPDB MotifACGCGC  PLACE Motif 
 AtREG395 GCGCGTGA    PPDB MotifACGCGC  PLACE Motif 
 AtREG489    CGTGACGTABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4-29117186AT1G77480.2, AT1G77480.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneCclone-29117346AT1G77480.2, AT1G77480.1
TSS cloneCclone-29117324AT1G77480.2, AT1G77480.1
TSS cloneAclone-29117319AT1G77480.2, AT1G77480.1
TSS cloneAclone-29117250AT1G77480.2, AT1G77480.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAAAAGCC-2911723129117238AT1G77480.1, AT1G77480.2
 AtREG589AAAAAGCC PPDB Motif  PLACE Motif 
REGGGCGCGTG-2911742329117430AT1G77480.1, AT1G77480.2
 AtREG486GGCGCGTG PPDB MotifACGCGC  PLACE Motif 
REGGTTAGGCCTTTG-2911744529117456AT1G77480.1, AT1G77480.2
 AtREG535GTTAGGCC     PPDB Motif  PLACE Motif 
 AtREG656    GGCCTTTG PPDB Motif  PLACE Motif 
REGATATTGGGCCCT-2911747229117483AT1G77480.1, AT1G77480.2
 AtREG509ATATTGGG     PPDB Motif  PLACE Motif 
 AtREG355 TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392   TTGGGCCC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG400    TGGGCCCT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.