version
PlantPromoterDB promoter information of AT1G77690.1

Summary of Gene (AT1G77690.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G77690  TAIR      NCBI 
Gene model AT1G77690.1  
Description Encodes an auxin influx carrier LAX3 (Like Aux1) that promotes lateral root emergence. Auxin-induced expression of LAX3 in turn induces a selection of cell-wall-remodelling enzymes, which are likely to promote cell separation in advance of developing lateral root primordia.  
#
#

Overview

Focused view (chromosome 1: 29204317-29203118)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G77690.1                      5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G77690.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA15-29203339-22

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-29203340-23
TSS cloneAclone-29203328-11

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATAAACCGA-2920350929203517-192-200
 AtREG598ATAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGACGCCACG-2920357529203582-258-265
 AtREG508ACGCCACG PPDB Motif  PLACE MotifGCCAC 
REGCAAGCCCATTAA-2920359029203601-273-284
 AtREG525CAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372  AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357   GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG396    CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGTATGGCCCATAAGCCCAACA-2920360929203628-292-311
 AtREG479TATGGCCC             PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG437 ATGGCCCA            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490  TGGCCCAT           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364   GGCCCATA          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG394    GCCCATAA         PPDB MotifGCCCA  PLACE Motif 
 AtREG462        ATAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG426         TAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407          AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG574           AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG543            GCCCAACA PPDB MotifGCCCA  PLACE MotifCAACA 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.