version
PlantPromoterDB promoter information of AT1G78040.2

Summary of Gene (AT1G78040.2)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G78040  TAIR      NCBI 
Gene model AT1G78040.2  
Description pollen Ole e 1 allergen and extensin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: in 10 processes; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pollen Ole e 1 allergen and extensin (InterPro:IPR006041), TonB box, conserved site (InterPro:IPR010916); BEST Arabidopsis thaliana protein match is: SAH7 (TAIR:AT4G08685.1); Has 188 Blast hits to 188 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 188; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 29344993-29346192)

Genome position     
from initiation codon
AT1G78040.1         
TSS from cDNA
TSS information
AT1G78040.2                      5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G78040.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA174+29345941-52

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+29345845-148
TSS cloneAclone+29345851-142
TSS cloneCclone+29345860-133
TSS cloneCclone+29345862-131
TSS cloneTclone+29345863-130
TSS cloneAclone+29345903-90
TSS cloneAclone+29345904-89
TSS cloneAclone+29345910-83
TSS cloneCclone+29345911-82
TSS cloneAclone+29345913-80
TSS cloneTclone+29345914-79
TSS cloneTclone+29345932-61
TSS cloneTclone+29345933-60
TSS cloneCclone+29345934-59
TSS cloneCclone+29345935-58
TSS cloneTclone+29345936-57
TSS cloneAclone+29345941-52
TSS cloneCclone+29345942-51
TSS cloneAclone+29345946-47
TSS cloneTclone+29345976-17

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTTCTTC+2934591429345924-79-69
Y PatchCTTCCTTCTC+2934593129345940-62-53
Y PatchCTTCTCTCTCTCTCTCT+2934596429345980-29-13
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATGCCACGT+2934575229345760-241-233
 AtREG448ATGCCACG ABA, DREB1Aox PPDB Motif  PLACE MotifGCCAC 
 AtREG379 TGCCACGTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
REGAAATACCCC+2934578829345796-205-197
 AtREG602AAATACCC  PPDB Motif  PLACE Motif 
 AtREG614 AATACCCC PPDB MotifACCCCT  PLACE Motif 
REGTGGGCTAA+2934584529345852-148-141
 AtREG571TGGGCTAA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTCACGCGCTT+2934585529345864-138-129
 AtREG395TCACGCGC   PPDB MotifACGCGC  PLACE Motif 
 AtREG381 CACGCGCT  PPDB MotifACGCGC  PLACE Motif 
 AtREG492  ACGCGCTT PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.