version
PlantPromoterDB promoter information of AT1G78570.1

Summary of Gene (AT1G78570.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G78570  TAIR      NCBI 
Gene model AT1G78570.1  
Description Encodes a UDP-L-Rhamnose synthase involved in the biosynthesis of rhamnose, a major monosaccharide component of pectin. Catalyzes the conversion of UDP-D-Glc to UDP-L-Rha. The dehydrogenase domain of RHM1 was shown to catalyze the conversion of UDP-D-Glc to the reaction intermediate UDP-4-keto-6-deoxy-D-Glc using recombinant protein assay but the activity of the full-length protein was not determined as it could not be expressed in <i>E. coli</i>.  
#
#

Overview

Focused view (chromosome 1: 29549110-29550309)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G78570.1                      5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G78570.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA59+29549650-460

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+29549650-460
TSS cloneGclone+29549651-459
TSS cloneGclone+29549696-414

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxAGTATATAATG+2954961429549624-496-486
Y PatchCTTCCCTCTCC+2954963929549649-471-461
Y PatchTTCTCTTCTTCTTCT+2954966829549682-442-428
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAAAACGCG+2954951929549527-591-583
 AtREG585CAAAACGC  PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
 AtREG566 AAAACGCG PPDB MotifAAACG(C/G)  PLACE Motif 
REGAAGGGTATTT+2954959029549599-520-511
 AtREG623AAGGGTAT   PPDB MotifACCCT  PLACE Motif 
 AtREG567 AGGGTATT  PPDB MotifACCCT  PLACE Motif 
 AtREG602  GGGTATTT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.