version
PlantPromoterDB promoter information of AT1G78590.1

Summary of Gene (AT1G78590.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G78590  TAIR      NCBI 
Gene model AT1G78590.1  
Description Encodes a NADH kinase which can synthesize NADPH from NADH; also utilizes NAD+ as substrate although NADH is the preferred substrate.  
#
#

Overview

Focused view (chromosome 1: 29563343-29564542)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G78590.1                      5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G78590.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA17+29564253-90

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+29564249-94
TSS cloneTclone+29564272-71

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTTC+2956427229564280-71-63
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAAACCGG+2956409329564100-250-243
 AtREG496CAAACCGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGTGAACCGGTC+2956413529564144-208-199
 AtREG480TGAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528 GAACCGGT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG552  AACCGGTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTTAGGCC+2956415629564163-187-180
 AtREG535GTTAGGCC PPDB Motif  PLACE Motif 
REGAGTTGGGCCTATT+2956418329564195-160-148
 AtREG607AGTTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG449 GTTGGGCC     PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358   TGGGCCTA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG362    GGGCCTAT  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG424     GGCCTATT PPDB Motif  PLACE Motif 
REGTGTTGGGCTC+2956419729564206-146-137
 AtREG543TGTTGGGC   PPDB MotifGCCCA  PLACE MotifCAACA 
 AtREG574 GTTGGGCT  PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG533  TTGGGCTC PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.