version
PlantPromoterDB promoter information of AT1G79280.1

Summary of Gene (AT1G79280.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G79280  TAIR      NCBI 
Gene model AT1G79280.1  
Description Encodes a 237-kDA protein with similarity to vertebrate Tpr, a long coiled-coil proteins of nuclear pore inner basket filaments. It is localized to the inner surface of the nuclear envelope and is a component of the nuclear pore-associated steps of sumoylation and mRNA export in plants. Mutations affect flowering time regulation and other developmental processes. Probably acts in the same pathway as ESD4 in affecting flowering time, vegetative and inflorescence development.  
#
#

Overview

Focused view (chromosome 1: 29833809-29832610)

Genome position     
from initiation codon
AT1G79290.1         
AT1G79300.1         
TSS from cDNA
TSS information
AT1G79280.1                      5'->3' (-)
Promoter sequence





 
AT1G79290           
AT1G79290.1         
AT1G79300           
AT1G79300.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G79280.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG2-29832950-141

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTCTCC-2983291129832919-102-110
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAACGACGT-2983300629833013-197-204
 AtREG493AACGACGT PPDB MotifACGT  PLACE MotifACGT 
REGTTCGGCCCAACT-2983302229833033-213-224
 AtREG427TTCGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG393 TCGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414  CGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG449   GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG607    GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGGGCCTAAT-2983304129833048-232-239
 AtREG506GGCCTAAT PPDB Motif  PLACE Motif 
REGGAAGCCCAACA-2983305229833062-243-253
 AtREG476GAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG574  AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG543   GCCCAACA PPDB MotifGCCCA  PLACE MotifCAACA 
REGGCCACGTGGTTAAAAGCCACGCGCT-2983313829833162-329-353
 AtREG367GCCACGTG                 ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG544  CACGTGGT               ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG549          TAAAAGCC        PPDB Motif  PLACE Motif 
 AtREG608             AAGCCACG    ABA PPDB Motif  PLACE MotifGCCAC 
 AtREG381                 CACGCGCT PPDB MotifACGCGC  PLACE Motif 
REGTCAAAACGCC-2983318529833194-376-385
 AtREG653TCAAAACG   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG585 CAAAACGC  PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
 AtREG650  AAAACGCC PPDB MotifAAACG(C/G)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.