version
PlantPromoterDB promoter information of AT1G79550

Summary of Gene (AT1G79550)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G79550  TAIR      NCBI 
Gene model AT1G79550  
Description Encodes cytosolic phosphoglycerate kinase (PGK).  
#
#

Overview

Focused view (chromosome 1: 29927295-29926096)

Genome position     
from initiation codon
AT1G79550.1         
AT1G79550.2         
TSS from cDNA
TSS information
AT1G79550                        5'->3' (-)
Promoter sequence








 
AT1G79560.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G79550

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG42-29926537-242

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-29926582-287
TSS cloneCclone-29926540-245
TSS cloneTclone-29926539-244
TSS cloneGclone-29926537-242
TSS cloneAclone-29926536-241
TSS cloneTclone-29926487-192
TSS cloneCclone-29926486-191
TSS cloneGclone-29926483-188
TSS cloneTclone-29926482-187
TSS cloneTclone-29926480-185
TSS cloneAclone-29926442-147
TSS cloneTclone-29926381-86

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTTATATAAG-2992656429926573-269-278
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAAACCGT-2992664729926655-352-360
 AtREG473TTAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG652 TAAACCGT PPDB Motif  PLACE Motif 
REGTCAGCCCACTA-2992667329926683-378-388
 AtREG609TCAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG510  AGCCCACT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG532   GCCCACTA PPDB MotifGCCCA  PLACE Motif 
REGTAATTGGGCTAGCCCATTAAG-2992668929926709-394-414
 AtREG600TAATTGGG              PPDB MotifGCCCA  PLACE Motif 
 AtREG418 AATTGGGC             PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581         TAGCCCAT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372          AGCCCATT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357           GCCCATTA   PPDB MotifGCCCA  PLACE Motif 
 AtREG396            CCCATTAA  PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG604             CCATTAAG PPDB Motif  PLACE MotifTTAATGG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA2+29926743AT1G79560.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+29926794AT1G79560.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxATTATATAAC+2992670629926715AT1G79560.1
Y PatchTCTTTCTCCTTC+2992675129926762AT1G79560.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACGGTTTAA+2992664729926655AT1G79560.1
 AtREG652ACGGTTTA  PPDB Motif  PLACE Motif 
 AtREG473 CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTAGTGGGCTGA+2992667329926683AT1G79560.1
 AtREG532TAGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG510 AGTGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG609   TGGGCTGA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCTTAATGGGCTA+2992668929926700AT1G79560.1
 AtREG604CTTAATGG     PPDB Motif  PLACE MotifTTAATGG 
 AtREG396 TTAATGGG    PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357  TAATGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG372   AATGGGCT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581    ATGGGCTA PPDB MotifGCCCA  PLACE MotifTGGGCY 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.