version
PlantPromoterDB promoter information of AT1G79650.1

Summary of Gene (AT1G79650.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G79650  TAIR      NCBI 
Gene model AT1G79650.1  
Description putative DNA repair protein RAD23  
#
#

Overview

Focused view (chromosome 1: 29976132-29974933)

Genome position     
from initiation codon
AT1G79650.2         
AT1G79650.3         
TSS from cDNA
TSS information
AT1G79650.1                      5'->3' (-)
Promoter sequence




 
AT1G79660.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G79650.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG2-29975271-139

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-29975269-137

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGTCACGTGGAT-2997532929975340-197-208
 AtREG606TGTCACGT    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG583 GTCACGTG    PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG408   CACGTGGA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG547    ACGTGGATABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGTGGGCCGAA-2997535429975362-222-230
 AtREG393TGGGCCGA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG427 GGGCCGAA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGGGGCCTTACTGGGCTATT-2997539829975415-266-283
 AtREG351GGGCCTTA           PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG530 GGCCTTAC          PPDB Motif  PLACE Motif 
 AtREG434      TACTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG584          GGGCTATT PPDB MotifGCCCA  PLACE Motif 
REGAGCCCACTA-2997542129975429-289-297
 AtREG510AGCCCACT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG532 GCCCACTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG5+29975660AT1G79660.1
TSS peakC5+29975754AT1G79660.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+29975701AT1G79660.1
TSS cloneAclone+29975863AT1G79660.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTTATAAAAA+2997562929975638AT1G79660.1
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAATAGCCCAGTAAGGCCC+2997539829975415AT1G79660.1
 AtREG584AATAGCCC           PPDB MotifGCCCA  PLACE Motif 
 AtREG434    GCCCAGTA       PPDB MotifGCCCA  PLACE Motif 
 AtREG530         GTAAGGCC  PPDB Motif  PLACE Motif 
 AtREG351          TAAGGCCC PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTAGTGGGCT+2997542129975429AT1G79660.1
 AtREG532TAGTGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG510 AGTGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTAAAAGCC+2997559029975597AT1G79660.1
 AtREG549TAAAAGCC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.