version
PlantPromoterDB promoter information of AT1G79710.1

Summary of Gene (AT1G79710.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G79710  TAIR      NCBI 
Gene model AT1G79710.1  
Description integral membrane transporter family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196), Biopterin transport-related protein BT1 (InterPro:IPR004324); BEST Arabidopsis thaliana protein match is: integral membrane transporter family protein (TAIR:AT5G25050.1); Has 694 Blast hits to 685 proteins in 112 species: Archae - 4; Bacteria - 113; Metazoa - 0; Fungi - 0; Plants - 141; Viruses - 0; Other Eukaryotes - 436 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 29994137-29995336)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G79710.1                      5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G79710.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG2+29995112-25

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTTCTATATAGT+2999507529995086-62-51
Y PatchCTTCTCTCTCT+2999512529995135-12-2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAAGCCCAC+2999481429994822-323-315
 AtREG476GAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518 AAGCCCAC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCAATGGGCCCAAAT+2999483929994852-298-285
 AtREG551CAATGGGC       PPDB MotifGCCCA  PLACE Motif 
 AtREG361 AATGGGCC      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG391  ATGGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422   TGGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392    GGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373     GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG421      GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGCTAATGGGCCACAAAAAGCCCATCT+2999487629994900-261-237
 AtREG558CTAATGGG                  PPDB MotifGCCCA  PLACE Motif 
 AtREG357 TAATGGGC                 PPDB MotifGCCCA  PLACE Motif 
 AtREG361  AATGGGCC                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490   ATGGGCCA               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG445    TGGGCCAC              PPDB MotifGCCCA  PLACE MotifGCCAC, GGGCC, TGGGCY 
 AtREG589            AAAAAGCC      PPDB Motif  PLACE Motif 
 AtREG409             AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376              AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378               AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG572                 GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGCGTGACGT+2999501729995024-120-113
 AtREG489CGTGACGTABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.