version
PlantPromoterDB promoter information of AT1G80500.1

Summary of Gene (AT1G80500.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G80500  TAIR      NCBI 
Gene model AT1G80500.1  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport, ER to Golgi vesicle-mediated transport; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sedlin (InterPro:IPR006722), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G20930.1); Has 437 Blast hits to 435 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 248; Fungi - 75; Plants - 53; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 30270195-30271394)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G80500.1                      5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G80500.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13+30270634-561

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+30270576-619
TSS cloneGclone+30270577-618
TSS cloneTclone+30270642-553

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCGTTAAA+3027044030270449-755-746
 AtREG399GCCCGTTA   PPDB MotifACGGGC  PLACE MotifYAACKG, CNGTTR 
 AtREG610  CCGTTAAA PPDB Motif  PLACE MotifYAACKG, CNGTTR 
REGCCCAATAGCCCAATAT+3027045230270467-743-728
 AtREG624CCCAATAG         PPDB MotifGCCCA  PLACE Motif 
 AtREG584   AATAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG402      AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355       GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG509        CCCAATAT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.