version
PlantPromoterDB promoter information of AT1G80670.1

Summary of Gene (AT1G80670.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G80670  TAIR      NCBI 
Gene model AT1G80670.1  
Description This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase  
#
#

Overview

Focused view (chromosome 1: 30324543-30323344)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G80670.1                      5'->3' (-)
Promoter sequence











 
AT1G80680.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G80670.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakC2-30323782-239

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-30323780-237

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAGTCAACATTGGGCCATAATAAGGCCCAAATATTAGGCCC-3032384730323888-304-345
 AtREG632AAAGTCAA                                   PPDB Motif  PLACE MotifTTGAC 
 AtREG461        CATTGGGC                           PPDB MotifGCCCA  PLACE Motif 
 AtREG352         ATTGGGCC                          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420          TTGGGCCA                         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG437           TGGGCCAT                        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG479            GGGCCATA                       PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG425                    ATAAGGCC               PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG351                     TAAGGCCC              PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353                      AAGGCCCA             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356                       AGGCCCAA            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373                        GGCCCAAA           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG421                         GCCCAAAT          PPDB MotifGCCCA  PLACE Motif 
 AtREG506                                 ATTAGGCC  PPDB Motif  PLACE Motif 
 AtREG360                                  TTAGGCCC PPDB MotifGCCCA  PLACE MotifGGGCC 
REGACCCGACCCGAACCGA-3032390330323918-360-375
 AtREG405ACCCGACC         PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG442 CCCGACCC        PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG375  CCGACCCG       PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG383   CGACCCGA      PPDB Motif  PLACE Motif 
 AtREG597    GACCCGAA     PPDB MotifGGGACCC  PLACE Motif 
 AtREG456       CCGAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG575        CGAACCGA PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.