version
PlantPromoterDB promoter information of AT1G80750.1

Summary of Gene (AT1G80750.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G80750  TAIR      NCBI 
Gene model AT1G80750.1  
Description 60S ribosomal protein L7 (RPL7A); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, nucleolus, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7D) (TAIR:AT3G13580.3); Has 856 Blast hits to 856 proteins in 248 species: Archae - 76; Bacteria - 0; Metazoa - 354; Fungi - 146; Plants - 114; Viruses - 0; Other Eukaryotes - 166 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 30348052-30349251)

Genome position     
from initiation codon
AT1G80745.1         
TSS from cDNA
TSS information
AT1G80750.1                      5'->3' (+)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G80750.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG13+30348823-229

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+30348801-251
TSS cloneGclone+30348823-229
TSS cloneTclone+30348825-227
TSS cloneCclone+30348827-225

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTAAGGCCTTACATAAGCCCATAAATATTGGGCTTTTTTAGCCCAATAG+3034867030348718-382-334
 AtREG530GTAAGGCCTTAC                                      PPDB Motif  PLACE Motif 
 AtREG462            ATAAGCCC                              PPDB MotifGCCCA  PLACE Motif 
 AtREG426             TAAGCCCA                             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378              AAGCCCAT                            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477               AGCCCATA                           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG394                GCCCATAA                          PPDB MotifGCCCA  PLACE Motif 
 AtREG509                        ATATTGGG                  PPDB Motif  PLACE Motif 
 AtREG407                           TTGGGCTT               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376                            TGGGCTTT              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409                             GGGCTTTT             PPDB MotifGCCCA  PLACE Motif 
 AtREG589                              GGCTTTTT            PPDB Motif  PLACE Motif 
 AtREG571                                     TTAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402                          ATTGGGCT     AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355                         TATTGGGC       GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG624                                         CCCAATAG PPDB MotifGCCCA  PLACE Motif 
REGCGTAATTA+3034874030348747-312-305
 AtREG646CGTAATTAABA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.