version
PlantPromoterDB promoter information of AT2G02500

Summary of Gene (AT2G02500)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G02500  TAIR      NCBI 
Gene model AT2G02500  
Description Encodes a protein with 4-Diphosphocytidyl-2C-methyl-D-erythritol synthase activity. The enzyme has an absolute requirement for divalent cations (Mg2+ reaches the highest catalytic activity).  
#
#

Overview

Focused view (chromosome 2: 674124-672925)

Genome position     
from initiation codon
AT2G02500.1         
TSS from cDNA
TSS information
AT2G02500                        5'->3' (-)
Promoter sequence












 
AT2G02510.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence












 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G02500

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-673155-31

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCTTATATATATATT-673174673188-50-64
Y PatchCTTTCTTCTTCTCTC-673139673153-15-29
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAATGGGCCTGATGGGCTTAT-673202673223-78-99
 AtREG396TTAATGGG               PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357 TAATGGGC              PPDB MotifGCCCA  PLACE Motif 
 AtREG361  AATGGGCC             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   ATGGGCCT            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG370    TGGGCCTG           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG374     GGGCCTGA          PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG635          TGATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG378            ATGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426             TGGGCTTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG462              GGGCTTAT PPDB MotifGCCCA  PLACE Motif 
REGTTATGGGCCTTATTAAAAGCCCATTAG-673237673263-113-139
 AtREG394TTATGGGC                    PPDB MotifGCCCA  PLACE Motif 
 AtREG364 TATGGGCC                   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  ATGGGCCT                  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353   TGGGCCTT                 PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG351    GGGCCTTA                PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG425     GGCCTTAT               PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG549             TAAAAGCC       PPDB Motif  PLACE Motif 
 AtREG409              AAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376               AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378                AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372                 AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357                  GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG558                   CCCATTAG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA13+673333AT2G02510.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+673305AT2G02510.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTGACTTT+673054673061AT2G02510.1
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 
REGTCCGGTTC+673155673162AT2G02510.1
 AtREG579TCCGGTTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGATAAGGCC+673183673190AT2G02510.1
 AtREG425ATAAGGCC PPDB MotifAACCG(G/A)  PLACE Motif 
REGATAAGCCCATCAGGCCCATTAA+673202673223AT2G02510.1
 AtREG462ATAAGCCC               PPDB MotifGCCCA  PLACE Motif 
 AtREG426 TAAGCCCA              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  AAGCCCAT             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG635    GCCCATCA           PPDB MotifGCCCA  PLACE Motif 
 AtREG374         TCAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG370          CAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354           AGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361            GGCCCATT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357             GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG396              CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGCTAATGGGCTTTTAATAAGGCCCATAA+673237673263AT2G02510.1
 AtREG558CTAATGGG                    PPDB MotifGCCCA  PLACE Motif 
 AtREG357 TAATGGGC                   PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT                  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT                 PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376    TGGGCTTT                PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409     GGGCTTTT               PPDB MotifGCCCA  PLACE Motif 
 AtREG549      GGCTTTTA              PPDB Motif  PLACE Motif 
 AtREG425              ATAAGGCC      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG351               TAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353                AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354                 AGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364                  GGCCCATA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG394                   GCCCATAA PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.