version
PlantPromoterDB promoter information of AT2G04630.1

Summary of Gene (AT2G04630.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G04630  TAIR      NCBI 
Gene model AT2G04630.1  
Description One of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At5g51940.  
#
#

Overview

Focused view (chromosome 2: 1621246-1620047)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G04630.1                      5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G04630.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13-1620319-73

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-1620311-65

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAACCGG-16203691620376-123-130
 AtREG542AAAACCGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAAACCGGTC-16203971620406-151-160
 AtREG542AAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436 AAACCGGT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG552  AACCGGTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTGGGCTTAAATGGG-16204171620431-171-185
 AtREG518GTGGGCTT        PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426 TGGGCTTA       PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG443       TAAATGGG PPDB MotifGCCCA  PLACE Motif 
REGCCGACCCGACCCTGACCCGAA-16204771620497-231-251
 AtREG375CCGACCCG              PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG383 CGACCCGA             PPDB Motif  PLACE Motif 
 AtREG390  GACCCGAC            PPDB MotifCCGAC, GGGACCC  PLACE MotifCCGAC 
 AtREG405   ACCCGACC           PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG442    CCCGACCC          PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG617            TGACCCGA  PPDB Motif  PLACE Motif 
 AtREG597             GACCCGAA PPDB MotifGGGACCC  PLACE Motif 
REGCCGAACCGAACCCGACCCGAA-16205591620579-313-333
 AtREG456CCGAACCG              PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG575 CGAACCGA             PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556   AACCGAAC           PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451    ACCGAACC          PPDB Motif  PLACE Motif 
 AtREG580        AACCCGAC      PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG405         ACCCGACC     PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG442          CCCGACCC    PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG375           CCGACCCG   PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG383            CGACCCGA  PPDB Motif  PLACE Motif 
 AtREG597             GACCCGAA PPDB MotifGGGACCC  PLACE Motif 
REGCGGACCCGAA-16205861620595-340-349
 AtREG491CGGACCCG   PPDB Motif  PLACE Motif 
 AtREG597  GACCCGAA PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.