version
PlantPromoterDB promoter information of AT2G14910.1

Summary of Gene (AT2G14910.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G14910  TAIR      NCBI 
Gene model AT2G14910.1  
Description unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G14970.1); Has 495 Blast hits to 336 proteins in 81 species: Archae - 0; Bacteria - 243; Metazoa - 19; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 182 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 6410015-6408816)

Genome position     
from initiation codon
AT2G14910.2         
TSS from cDNA
TSS information
AT2G14910.1                      5'->3' (-)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G14910.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA85-6409097-82

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-6409171-156
TSS cloneTclone-6409169-154
TSS cloneTclone-6409165-150
TSS cloneTclone-6409141-126
TSS cloneTclone-6409136-121
TSS cloneAclone-6409130-115
TSS cloneTclone-6409100-85
TSS cloneAclone-6409097-82
TSS cloneTclone-6409089-74
TSS cloneTclone-6409046-31
TSS cloneAclone-6409045-30

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGTCACGT-64091516409158-136-143
 AtREG606TGTCACGTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGATAACCGGTC-64092086409217-193-202
 AtREG548ATAACCGG   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG503 TAACCGGT  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG552  AACCGGTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAAACCGG-64092346409241-219-226
 AtREG542AAAACCGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGTGAACCGGAC-64092526409261-237-246
 AtREG480TGAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579 GAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG573  AACCGGAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTAAAGCC-64093246409331-309-316
 AtREG545TTAAAGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.