version
PlantPromoterDB promoter information of AT2G16500.1

Summary of Gene (AT2G16500.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G16500  TAIR      NCBI 
Gene model AT2G16500.1  
Description encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Promoter region of ADC1 contains 742-bp AT-rich transposable element, called AtATE, that belongs to the MITE families of repetitive elements.  
#
#

Overview

Focused view (chromosome 2: 7153904-7152705)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G16500.1                      5'->3' (-)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G16500.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4-7153282-378
TSS peakG4-7153055-151

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-7153339-435
TSS cloneAclone-7153336-432
TSS cloneTclone-7153250-346

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCCTTCT-71530627153070-158-166
Y PatchCGTCTCTCTTCC-71533087153319-404-415
Y PatchCTCTCTTCTT-71533237153332-419-428
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTCGGGTCGGGTCGGGTCG-71531117153129-207-225
 AtREG597TTCGGGTC            PPDB MotifGGGACCC  PLACE Motif 
 AtREG383 TCGGGTCGGGTCGGGTCG PPDB Motif  PLACE Motif 
 AtREG375  CGGGTCGGGTCGG     PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG442   GGGTCGGGTCGGG    PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG405    GGTCGGGTCGGGT   PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG390     GTCGGGTCGGGTC  PPDB MotifCCGAC, GGGACCC  PLACE MotifCCGAC 
REGTAGGGCCCAAGCCCAAAA-71534257153442-521-538
 AtREG387TAGGGCCC           PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG400 AGGGCCCA          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392  GGGCCCAA         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG505   GGCCCAAG        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG525       CAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407        AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469         AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG529          GCCCAAAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.