version
PlantPromoterDB promoter information of AT2G16510.1

Summary of Gene (AT2G16510.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G16510  TAIR      NCBI 
Gene model AT2G16510.1  
Description vacuolar ATP synthase 16 kDa proteolipid subunit 5 / V-ATPase 16 kDa proteolipid subunit 5 (AVAP5); FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C, eukaryotic (InterPro:IPR011555), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is: ATVHA-C3 (VACUOLAR-TYPE H(+)-ATPASE C3); ATPase (TAIR:AT4G38920.1); Has 1813 Blast hits to 1633 proteins in 398 species: Archae - 127; Bacteria - 309; Metazoa - 519; Fungi - 314; Plants - 224; Viruses - 0; Other Eukaryotes - 320 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 7161811-7160612)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G16510.1                      5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G16510.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA48-7160889-78

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-7160892-81
TSS cloneTclone-7160888-77
TSS cloneAclone-7160884-73

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCTCTCTCTCCCTCC-71608537160870-42-59
Y PatchTTCTCTTCC-71608947160902-83-91
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCGACCCGGCCCAAAA-71609507160965-139-154
 AtREG539TCGACCCG         PPDB Motif  PLACE Motif 
 AtREG494 CGACCCGG        PPDB Motif  PLACE Motif 
 AtREG404    CCCGGCCC    CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG457     CCGGCCCA   CK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414      CGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373       GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG529        GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGTAAATGGGCTTTAA-71609687160981-157-170
 AtREG443TAAATGGG       PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376    TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365     GGGCTTTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG545      GGCTTTAA PPDB Motif  PLACE Motif 
REGAATAGCCCAT-71610057161014-194-203
 AtREG584AATAGCCC   PPDB MotifGCCCA  PLACE Motif 
 AtREG581  TAGCCCAT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTATATGGG-71610287161035-217-224
 AtREG620TATATGGG PPDB MotifGCCCA  PLACE Motif 
REGAATAGCCCATTTA-71610387161050-227-239
 AtREG584AATAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG581  TAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372   AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386    GCCCATTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG443     CCCATTTA PPDB MotifGCCCA  PLACE Motif 
REGCCCAATTA-71610707161077-259-266
 AtREG600CCCAATTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.