version
PlantPromoterDB promoter information of AT2G17350.1

Summary of Gene (AT2G17350.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G17350  TAIR      NCBI 
Gene model AT2G17350.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 93 Blast hits to 67 proteins in 31 species: Archae - 0; Bacteria - 1; Metazoa - 16; Fungi - 13; Plants - 21; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 7547148-7545949)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G17350.1                      5'->3' (-)
Promoter sequence














 
AT2G17360.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence














 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G17350.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4-7546345-197

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-7546367-219
TSS cloneGclone-7546366-218
TSS cloneTclone-7546340-192
TSS cloneTclone-7546338-190
TSS cloneCclone-7546331-183

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTTCTTCCTC-75463217546331-173-183
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACAGGCCCAATATAGGCCCAATAAG-75464147546438-266-290
 AtREG433ACAGGCCC                  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG370 CAGGCCCA                 PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA   AGGCCCAA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352   GGCCCAAT   GGCCCAAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355    GCCCAATA   GCCCAATA   PPDB MotifGCCCA  PLACE Motif 
 AtREG509     CCCAATAT             PPDB Motif  PLACE Motif 
 AtREG487          TATAGGCC        PPDB Motif  PLACE Motif 
 AtREG362           ATAGGCCC       PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358            TAGGCCCA      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG417                CCCAATAA  PPDB MotifGCCCA  PLACE Motif 
 AtREG611                 CCAATAAG PPDB Motif  PLACE Motif 
REGCACACGTGTGA-75464517546461-303-313
 AtREG460CACACGTGTG ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG588   ACGTGTGAABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGCAAAGCCCTA-75465027546511-354-363
 AtREG559CAAAGCCC   PPDB MotifGCCCA  PLACE Motif 
 AtREG651  AAGCCCTA PPDB Motif  PLACE Motif 
REGTCTAGGGT-75465307546537-382-389
 AtREG658TCTAGGGT PPDB MotifACCCT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA21+7546578AT2G17360.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneCclone+7546519AT2G17360.1
TSS cloneCclone+7546525AT2G17360.1
TSS cloneTclone+7546526AT2G17360.1
TSS cloneAclone+7546528AT2G17360.1
TSS cloneGclone+7546536AT2G17360.1
TSS cloneTclone+7546543AT2G17360.1
TSS cloneCclone+7546568AT2G17360.1
TSS cloneGclone+7546572AT2G17360.1
TSS cloneAclone+7546578AT2G17360.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTTCTCT+75466157546625AT2G17360.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCTTATTGGGCCTATATTGGGCCTGT+75464147546438AT2G17360.1
 AtREG611CTTATTGG                  PPDB Motif  PLACE Motif 
 AtREG417 TTATTGGG                 PPDB MotifGCCCA  PLACE Motif 
 AtREG355  TATTGGGC   TATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG352   ATTGGGCC   ATTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356    TTGGGCCT   TTGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358     TGGGCCTA             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG362      GGGCCTAT            PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG487       GGCCTATA           PPDB Motif  PLACE Motif 
 AtREG509            ATATTGGG      PPDB Motif  PLACE Motif 
 AtREG370                TGGGCCTG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG433                 GGGCCTGT PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTCACACGTGTG+75464517546461AT2G17360.1
 AtREG588TCACACGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG460 CACACGTGTGABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
REGTAGGGCTTTG+75465027546511AT2G17360.1
 AtREG651TAGGGCTT   PPDB Motif  PLACE Motif 
 AtREG559  GGGCTTTG PPDB MotifGCCCA  PLACE Motif 
REGACCCTAGA+75465307546537AT2G17360.1
 AtREG658ACCCTAGA PPDB MotifACCCT  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.