version
PlantPromoterDB promoter information of AT2G17840.1

Summary of Gene (AT2G17840.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G17840  TAIR      NCBI 
Gene model AT2G17840.1  
Description Identified as drought-inducible gene by differential hybridization. Upregulated by high light, drought, cold and salt stress determined by microarray analysis.  
#
#

Overview

Focused view (chromosome 2: 7758798-7757599)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G17840.1                      5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G17840.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA26-7757848-50

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-7757852-54
TSS cloneAclone-7757848-50
TSS cloneAclone-7757847-49
TSS cloneAclone-7757843-45

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxAATATAAATA-77578747757883-76-85
Y PatchTCTTCTCC-77578207757827-22-29
Y PatchCCTTCTTCTTCTTC-77578857757898-87-100
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATCCACGT-77579447757951-146-153
 AtREG547ATCCACGTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGACACGCGTCATTT-77579617757973-163-175
 AtREG536ACACGCGT     ABA, Drought PPDB Motif  PLACE MotifACACNNG 
 AtREG657     CGTCATTT PPDB Motif  PLACE Motif 
REGAACCGAACCGGTTTAT-77579827757997-184-199
 AtREG556AACCGAAC         PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451 ACCGAACC        PPDB Motif  PLACE Motif 
 AtREG456  CCGAACCG       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423   CGAACCGG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528    GAACCGGT     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436      ACCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412       CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG598        CGGTTTAT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.