version
PlantPromoterDB promoter information of AT2G18020

Summary of Gene (AT2G18020)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G18020  TAIR      NCBI 
Gene model AT2G18020  
Description embryo defective 2296 (EMB2296); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: in 7 components; EXPRESSED IN: male gametophyte, guard cell, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein L2, domain 3 (InterPro:IPR014726), Ribosomal protein L2 (InterPro:IPR002171); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L8 (RPL8C) (TAIR:AT4G36130.1); Has 7419 Blast hits to 7417 proteins in 2201 species: Archae - 236; Bacteria - 3117; Metazoa - 334; Fungi - 188; Plants - 928; Viruses - 0; Other Eukaryotes - 2616 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 7836151-7837350)

Genome position     
from initiation codon
AT2G18020.1         
TSS from cDNA
TSS information
AT2G18020                        5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G18020

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG219+7837106-45

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+7837087-64
TSS cloneAclone+7837102-49
TSS cloneTclone+7837104-47
TSS cloneGclone+7837106-45
TSS cloneTclone+7837109-42
TSS cloneTclone+7837111-40
TSS cloneAclone+7837113-38

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTTGGGCTTTTT+78368597836870-292-281
 AtREG574GTTGGGCT     PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG407 TTGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376  TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409   GGGCTTTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG589    GGCTTTTT PPDB Motif  PLACE Motif 
REGCTTAGGCCCATTAG+78370337837046-118-105
 AtREG563CTTAGGCC       PPDB Motif  PLACE Motif 
 AtREG360 TTAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358  TAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   AGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361    GGCCCATT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357     GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG558      CCCATTAG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.