version
PlantPromoterDB promoter information of AT2G18915.2

Summary of Gene (AT2G18915.2)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G18915  TAIR      NCBI 
Gene model AT2G18915.2  
Description encodes a member of F-box proteins that includes two other proteins in Arabidopsis (ZTL and FKF1). These proteins contain a unique structure containing a PAS domain at their N-terminus, an F-box motif, and 6 kelch repeats at their C-terminus. Overexpression results in arrhythmic phenotypes for a number of circadian clock outputs in both constant light and constant darkness, long hypocotyls under multiple fluences of both red and blue light, and a loss of photoperiodic control of flowering time. Although this the expression of this gene itself is not regulated by circadian clock, it physically interacts with Dof transcription factors that are transcriptionally regulated by circadian rhythm. LKP2 interacts with Di19, CO/COL family proteins.  
#
#

Overview

Focused view (chromosome 2: 8198255-8197056)

Genome position     
from initiation codon
AT2G18915.1         
AT2G18917.1         
AT2G18920.1         
TSS from cDNA
TSS information
AT2G18915.2                      5'->3' (-)
Promoter sequence





 
AT2G18917           
AT2G18917.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G18915.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2-8197489-234

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-8197443-188

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCCTCTT-81975298197539-274-284
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAACCGGTC-81976178197625-362-370
 AtREG436AAACCGGT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG552 AACCGGTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGCTAAACCGGT-81976408197649-385-394
 AtREG511CTAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGT PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTAAACCGGAT-81976578197667-402-412
 AtREG519GTAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561   AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.