version
PlantPromoterDB promoter information of AT2G19680.2

Summary of Gene (AT2G19680.2)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G19680  TAIR      NCBI 
Gene model AT2G19680.2  
Description mitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrial proton-transporting ATP synthase complex, coupling factor F(o); EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT4G29480.1); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 8500865-8502064)

Genome position     
from initiation codon
AT2G19680.1         
TSS from cDNA
TSS information
AT2G19680.2                      5'->3' (+)
Promoter sequence






 
AT2G19670.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G19680.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA26+8501329-536

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+8501326-539

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCGGTTCAA+85012298501238-636-627
 AtREG637GCCGGTTC   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480 CCGGTTCA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG640  CGGTTCAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGATAAACCGGTTTGG+85012528501265-613-600
 AtREG598ATAAACCG       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496     CCGGTTTG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550      CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGATCCGGTTCGGTT+85012758501287-590-578
 AtREG561ATCCGGTT      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579 TCCGGTTC     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423  CCGGTTCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456   CGGTTCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451    GGTTCGGT  PPDB Motif  PLACE Motif 
 AtREG556     GTTCGGTT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone-8501159AT2G19670.1
TSS clone peakGclone-8501150AT2G19670.1
TSS cloneTclone-8501129AT2G19670.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.