version
PlantPromoterDB promoter information of AT2G20130.1

Summary of Gene (AT2G20130.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G20130  TAIR      NCBI 
Gene model AT2G20130.1  
Description LIKE COV 1 (LCV1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, flower, root, pollen tube, leaf; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF502 (InterPro:IPR007462); BEST Arabidopsis thaliana protein match is: COV1 (CONTINUOUS VASCULAR RING) (TAIR:AT2G20120.1); Has 1965 Blast hits to 1965 proteins in 370 species: Archae - 6; Bacteria - 694; Metazoa - 0; Fungi - 0; Plants - 85; Viruses - 0; Other Eukaryotes - 1180 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 8693234-8692035)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G20130.1                      5'->3' (-)
Promoter sequence






 
AT2G20140.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G20130.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2-8692413-179

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-8692406-172
TSS cloneGclone-8692391-157
TSS cloneAclone-8692373-139

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTTCTCT-86923968692405-162-171
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAGTCAA-86924988692505-264-271
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGTTCGGTTTAA-86925148692523-280-289
 AtREG568TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473  CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTCGGTTTAA-86925358692543-301-309
 AtREG514TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473 CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTAGTGGGCCTTAG-86926058692617-371-383
 AtREG532TAGTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG482  GTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353   TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG351    GGGCCTTA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG577     GGCCTTAG PPDB Motif  PLACE Motif 
REGTTTAGGCCTTTT-86926348692645-400-411
 AtREG430TTTAGGCC     PPDB Motif  PLACE Motif 
 AtREG459    GGCCTTTT PPDB Motif  PLACE Motif 
REGAGTGGGCTTAT-86926498692659-415-425
 AtREG510AGTGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518 GTGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426  TGGGCTTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG462   GGGCTTAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4+8692710AT2G20140.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+8692682AT2G20140.1
TSS cloneGclone+8692712AT2G20140.1
TSS cloneAclone+8692720AT2G20140.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCC+86926678692674AT2G20140.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTGACTTT+86924988692505AT2G20140.1
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 
REGTTAAACCGAA+86925148692523AT2G20140.1
 AtREG473TTAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTAAACCGA+86925358692543AT2G20140.1
 AtREG473TTAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCTAAGGCCCACTA+86926058692617AT2G20140.1
 AtREG577CTAAGGCC      PPDB Motif  PLACE Motif 
 AtREG351 TAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG482   AGGCCCAC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG532     GCCCACTA PPDB MotifGCCCA  PLACE Motif 
REGAAAAGGCCTAAA+86926348692645AT2G20140.1
 AtREG459AAAAGGCC     PPDB Motif  PLACE Motif 
 AtREG430    GGCCTAAA PPDB Motif  PLACE Motif 
REGATAAGCCCACT+86926498692659AT2G20140.1
 AtREG462ATAAGCCC    PPDB MotifGCCCA  PLACE Motif 
 AtREG426 TAAGCCCA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518  AAGCCCAC  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG510   AGCCCACT PPDB MotifGCCCA  PLACE MotifTGGGCY 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.