version
PlantPromoterDB promoter information of AT2G20770.1

Summary of Gene (AT2G20770.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G20770  TAIR      NCBI 
Gene model AT2G20770.1  
Description Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor.GCL2 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase.  
#
#

Overview

Focused view (chromosome 2: 8944380-8945579)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G20770.1                      5'->3' (+)
Promoter sequence





 
AT2G20760.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G20770.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG13+8945356-24

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+8945318-62

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTTCTTCT+89453288945336-52-44
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAACGCTG+89452078945214-173-166
 AtREG626AAACGCTG PPDB MotifAAACG(C/G)  PLACE Motif 
REGATGCCACGT+89452608945268-120-112
 AtREG448ATGCCACG ABA, DREB1Aox PPDB Motif  PLACE MotifGCCAC 
 AtREG379 TGCCACGTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
REGACCGAACCGGTC+89452938945304-87-76
 AtREG451ACCGAACC     PPDB Motif  PLACE Motif 
 AtREG456 CCGAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423  CGAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528   GAACCGGT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG552    AACCGGTC PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG28-8945223AT2G20760.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-8945222AT2G20760.1
TSS cloneGclone-8945212AT2G20760.1
TSS cloneTclone-8945175AT2G20760.1
TSS cloneAclone-8945168AT2G20760.1
TSS cloneAclone-8945162AT2G20760.1
TSS cloneTclone-8945139AT2G20760.1
TSS cloneTclone-8945131AT2G20760.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTTCTCTT-89451908945201AT2G20760.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGACCGGTTCGGT-89452938945304AT2G20760.1
 AtREG552GACCGGTT     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528 ACCGGTTC    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423  CCGGTTCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456   CGGTTCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451    GGTTCGGT PPDB Motif  PLACE Motif 
REGTAAACGACA-89453178945325AT2G20760.1
 AtREG565TAAACGAC  PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA PPDB Motif  PLACE Motif 
REGCCGTTAAA-89453608945367AT2G20760.1
 AtREG610CCGTTAAA PPDB Motif  PLACE MotifYAACKG, CNGTTR 
REGCCGACCCG-89453848945391AT2G20760.1
 AtREG375CCGACCCG PPDB MotifCCGAC  PLACE MotifCCGAC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.