version
PlantPromoterDB promoter information of AT2G21580.2

Summary of Gene (AT2G21580.2)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G21580  TAIR      NCBI 
Gene model AT2G21580.2  
Description 40S ribosomal protein S25 (RPS25B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25E) (TAIR:AT4G39200.2); Has 502 Blast hits to 502 proteins in 179 species: Archae - 5; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 9235629-9236828)

Genome position     
from initiation codon
AT2G21580.1         
TSS from cDNA
TSS information
AT2G21580.2                      5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G21580.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG44+9236552-77

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+9236553-76
TSS cloneCclone+9236554-75
TSS cloneGclone+9236555-74
TSS cloneTclone+9236556-73
TSS cloneTclone+9236558-71
TSS cloneTclone+9236597-32
TSS cloneCclone+9236599-30

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxAATATATAAATA+92365189236529-111-100
Y PatchTCTCTTCTCT+92365889236597-41-32
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAATTGGGCTTA+92363949236405-235-224
 AtREG600TAATTGGG     PPDB MotifGCCCA  PLACE Motif 
 AtREG418 AATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   TTGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426    TGGGCTTA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGATATTGGG+92364129236419-217-210
 AtREG509ATATTGGG PPDB Motif  PLACE Motif 
REGTTAATGGGCTTG+92364309236441-199-188
 AtREG396TTAATGGG     PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357 TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG525    TGGGCTTG PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTTAATGGGCTTT+92364619236472-168-157
 AtREG396TTAATGGG     PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357 TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376    TGGGCTTT PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.