version
PlantPromoterDB promoter information of AT2G26910.1

Summary of Gene (AT2G26910.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G26910  TAIR      NCBI 
Gene model AT2G26910.1  
Description PLEIOTROPIC DRUG RESISTANCE 4 (PDR4); FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: multidrug transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 (InterPro:IPR000412), Plant PDR ABC transporter associated (InterPro:IPR013581), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: PDR12 (PLEIOTROPIC DRUG RESISTANCE 12); ATPase, coupled to transmembrane movement of substances (TAIR:AT1G15520.1); Has 227772 Blast hits to 156896 proteins in 2502 species: Archae - 4872; Bacteria - 164954; Metazoa - 8485; Fungi - 4883; Plants - 3129; Viruses - 4; Other Eukaryotes - 41445 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 11480623-11481822)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G26910.1                      5'->3' (+)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G26910.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5+11481525-98

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTCCCTC+1148156211481572-61-51
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCGGTTCGGT+1148122711481236-396-387
 AtREG575TCGGTTCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456 CGGTTCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451  GGTTCGGT PPDB Motif  PLACE Motif 
REGTTCGGTTT+1148125511481262-368-361
 AtREG568TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.