version
PlantPromoterDB promoter information of AT2G28390.1

Summary of Gene (AT2G28390.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G28390  TAIR      NCBI 
Gene model AT2G28390.1  
Description SAND family protein; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar fusion protein MON1 (InterPro:IPR004353); Has 646 Blast hits to 487 proteins in 169 species: Archae - 4; Bacteria - 33; Metazoa - 275; Fungi - 161; Plants - 29; Viruses - 2; Other Eukaryotes - 142 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 12144375-12143176)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G28390.1                      5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G28390.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG5-12143512-137

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-12143465-90
TSS cloneAclone-12143451-76
TSS cloneAclone-12143445-70

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTTCCTC-1214348912143497-114-122
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAAGCCCAACA-1214356712143578-192-203
 AtREG409AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG574   AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG543    GCCCAACA PPDB MotifGCCCA  PLACE MotifCAACA 
REGCTATTGGG-1214358112143588-206-213
 AtREG624CTATTGGG PPDB MotifGCCCA  PLACE Motif 
REGATAAGCCCAA-1214362912143638-254-263
 AtREG462ATAAGCCC   PPDB MotifGCCCA  PLACE Motif 
 AtREG426 TAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.