version
PlantPromoterDB promoter information of AT2G28900

Summary of Gene (AT2G28900)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G28900  TAIR      NCBI 
Gene model AT2G28900  
Description Encodes AtOEP16, a 16-KDa plastid outer membrane protein involved in plastid import of protochlorophyllide oxidoreductase A. Predominantly expressed in leaves and is also inducible by cold treatment.  
#
#

Overview

Focused view (chromosome 2: 12417759-12416560)

Genome position     
from initiation codon
AT2G28910.1         
TSS from cDNA
TSS information
AT2G28900                        5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G28900

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakT4-12416187-728
TSS peakA4-12415527-68

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-12415578-119
TSS cloneCclone-12415550-91
TSS cloneAclone-12415549-90
TSS cloneAclone-12415548-89
TSS cloneGclone-12415532-73
TSS cloneCclone-12415528-69
TSS cloneGclone-12415526-67
TSS cloneAclone-12415521-62
TSS cloneAclone-12415517-58

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCTTTATAT-1241555312415561-94-102
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGGTCC-1241561912415626-160-167
 AtREG523GTGGGTCC PPDB MotifGGGACCC  PLACE Motif 
REGCGTCATTT-1241565812415665-199-206
 AtREG657CGTCATTT PPDB Motif  PLACE Motif 
REGGTGTCGTT-1241573012415737-271-278
 AtREG527GTGTCGTTDREB1Aox PPDB Motif  PLACE Motif 
REGACGTGTGA-1241622812416235-769-776
 AtREG588ACGTGTGAABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGGTTCGGTT-1241645712416464-998-1005
 AtREG556GTTCGGTT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA46-12417374AT2G28910.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone-12417387AT2G28910.1
TSS cloneCclone-12417385AT2G28910.1
TSS cloneTclone-12417384AT2G28910.1
TSS cloneGclone-12417379AT2G28910.1
TSS cloneCclone-12417378AT2G28910.1
TSS cloneCclone-12417375AT2G28910.1
TSS cloneGclone-12417373AT2G28910.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTTCCT-1241738412417391AT2G28910.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCAGGCCCAGCC-1241752112417532AT2G28910.1
 AtREG619CCAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG370 CAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG410  AGGCCCAG   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG454    GCCCAGCC PPDB MotifGCCCA  PLACE Motif 
REGCCAGGCCCAGCCCAAAT-1241754712417563AT2G28910.1
 AtREG619CCAGGCCC          PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG370 CAGGCCCA         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG410  AGGCCCAG        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG454    GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG469        AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG421         GCCCAAAT PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.