version
PlantPromoterDB promoter information of AT2G29540.1

Summary of Gene (AT2G29540.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G29540  TAIR      NCBI 
Gene model AT2G29540.1  
Description RNA polymerase I(A) and III(C) 14 kDa subunit  
#
#

Overview

Focused view (chromosome 2: 12641727-12642926)

Genome position     
from initiation codon
AT2G29540.2         
TSS from cDNA
TSS information
AT2G29540.1                      5'->3' (+)
Promoter sequence






 
AT2G29530.1         
AT2G29530.2         
AT2G29530.3         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G29540.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG2+12642501-226

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+12642521-206
TSS cloneTclone+12642524-203
TSS cloneTclone+12642612-115

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACGCCACGTCATC+1264242712642439-300-288
 AtREG508ACGCCACG      PPDB Motif  PLACE MotifGCCAC 
 AtREG371 CGCCACGT    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG388  GCCACGTC    PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG419   CCACGTCA   PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG483    CACGTCAT  PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG578     ACGTCATCABA PPDB MotifACGT  PLACE MotifACGT 
REGAAGGGTAT+1264244612642453-281-274
 AtREG623AAGGGTAT PPDB MotifACCCT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA5-12642384AT2G29530.1, AT2G29530.2, AT2G29530.3
TSS peakG5-12642265AT2G29530.1, AT2G29530.2, AT2G29530.3

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-12642308AT2G29530.1, AT2G29530.2, AT2G29530.3

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTATAAAG-1264229312642300AT2G29530.1, AT2G29530.2, AT2G29530.3
Y PatchCTTCTCCT-1264223212642239AT2G29530.1, AT2G29530.2, AT2G29530.3
Y PatchCCTCTCTTC-1264235512642363AT2G29530.1, AT2G29530.2, AT2G29530.3
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGATGACGTGGCGT-1264242712642439AT2G29530.1, AT2G29530.2, AT2G29530.3
 AtREG578GATGACGT     ABA PPDB MotifACGT  PLACE MotifACGT 
 AtREG483 ATGACGTG     PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG419  TGACGTGG    PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG388   GACGTGGC   PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG371    ACGTGGCG ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG508     CGTGGCGT PPDB Motif  PLACE MotifGCCAC 
REGATACCCTT-1264244612642453AT2G29530.1, AT2G29530.2, AT2G29530.3
 AtREG623ATACCCTT PPDB MotifACCCT  PLACE Motif 
REGCGTAATTA-1264245912642466AT2G29530.1, AT2G29530.2, AT2G29530.3
 AtREG646CGTAATTAABA PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.