version
PlantPromoterDB promoter information of AT2G30010

Summary of Gene (AT2G30010)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G30010  TAIR      NCBI 
Gene model AT2G30010  
Description INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF231, plant (InterPro:IPR004253); BEST Arabidopsis thaliana protein match is: PMR5 (POWDERY MILDEW RESISTANT 5) (TAIR:AT5G58600.1); Has 709 Blast hits to 698 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 709; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 12804333-12805532)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G30010                        5'->3' (+)
Promoter sequence

 
AT2G30000.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence











 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G30010

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+12805758-75
TSS clone peakGclone+12805787-46
TSS cloneTclone+12805798-35

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA2-12804977AT2G30000.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-12804977AT2G30000.1
TSS cloneTclone-12804976AT2G30000.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGACCCAC-1280503812805045AT2G30000.1
 AtREG523GGACCCAC PPDB MotifGGGACCC  PLACE Motif 
REGTTTGGGCTTTAA-1280505712805068AT2G30000.1
 AtREG469TTTGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 TTGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376  TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365   GGGCTTTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG545    GGCTTTAA PPDB Motif  PLACE Motif 
REGATAATGGGCTTTTA-1280507012805083AT2G30000.1
 AtREG546ATAATGGG       PPDB Motif  PLACE Motif 
 AtREG357 TAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376    TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409     GGGCTTTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG549      GGCTTTTA PPDB Motif  PLACE Motif 
REGCCGGTTTGG-1280511612805124AT2G30000.1
 AtREG496CCGGTTTG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550 CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGACCGGGTC-1280517112805178AT2G30000.1
 AtREG463ACCGGGTC PPDB MotifAACCG(G/A), GGGACCC  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.