version
PlantPromoterDB promoter information of AT2G30600

Summary of Gene (AT2G30600)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G30600  TAIR      NCBI 
Gene model AT2G30600  
Description BTB/POZ domain-containing protein; FUNCTIONS IN: protein binding; INVOLVED IN: cell adhesion; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ fold (InterPro:IPR011333), Coagulation factor 5/8 type, C-terminal (InterPro:IPR000421), BTB/POZ (InterPro:IPR013069), BTB/Kelch-associated (InterPro:IPR011705), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210), Galactose-binding like (InterPro:IPR008979); BEST Arabidopsis thaliana protein match is: BTB/POZ domain-containing protein (TAIR:AT2G46260.1); Has 5681 Blast hits to 5383 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 4936; Fungi - 16; Plants - 503; Viruses - 34; Other Eukaryotes - 192 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 13033010-13034209)

Genome position     
from initiation codon
AT2G30590.1         
TSS from cDNA
TSS information
AT2G30600                        5'->3' (+)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G30600

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+13036876-534
TSS cloneTclone+13037214-196
TSS clone peakTclone+13037230-180
TSS cloneTclone+13037232-178
TSS cloneGclone+13037239-171

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4+13033543AT2G30590.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+13033521AT2G30590.1
TSS cloneAclone+13033692AT2G30590.1
TSS cloneGclone+13033782AT2G30590.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTCTTTC+1303354913033559AT2G30590.1
Y PatchCCTCTCCT+1303358013033587AT2G30590.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAATTACGACCCGA+1303325813033271AT2G30590.1
 AtREG646TAATTACG      ABA PPDB Motif  PLACE Motif 
 AtREG383      CGACCCGA PPDB Motif  PLACE Motif 
REGGGACCCAC+1303328313033290AT2G30590.1
 AtREG523GGACCCAC PPDB MotifGGGACCC  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.