version
PlantPromoterDB promoter information of AT2G31610.1

Summary of Gene (AT2G31610.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G31610  TAIR      NCBI 
Gene model AT2G31610.1  
Description 40S ribosomal protein S3 (RPS3A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to salt stress, translation, response to abiotic stimulus; LOCATED IN: in 6 components; EXPRESSED IN: root, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: K Homology, prokaryotic type (InterPro:IPR009019), K Homology, type 2 (InterPro:IPR004044), K Homology (InterPro:IPR004087), Ribosomal protein S3, C-terminal (InterPro:IPR001351), Ribosomal protein S3, conserved site (InterPro:IPR018280), Ribosomal protein S3, eukaryotic/archaeal (InterPro:IPR005703); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S3 (RPS3B) (TAIR:AT3G53870.1); Has 3946 Blast hits to 3943 proteins in 1195 species: Archae - 174; Bacteria - 1992; Metazoa - 298; Fungi - 94; Plants - 101; Viruses - 0; Other Eukaryotes - 1287 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 13450134-13451333)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G31610.1                      5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G31610.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA85+13450313-71

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+13450307-77
TSS cloneAclone+13450313-71
TSS cloneCclone+13450314-70
TSS cloneCclone+13450322-62

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCAATATAAATA+1345027813450288-106-96
Y PatchTTCTCTTC+1345032613450333-58-51
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAAAGCCCATAA+1345018813450200-196-184
 AtREG545TTAAAGCC      PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477    AGCCCATA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG394     GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGCATTGGGCTGA+1345020713450217-177-167
 AtREG461CATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG402 ATTGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG609   TGGGCTGA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGAATAGGCCCAAAC+1345022913450241-155-143
 AtREG424AATAGGCC      PPDB Motif  PLACE Motif 
 AtREG362 ATAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358  TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373    GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG474     GCCCAAAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.