version
PlantPromoterDB promoter information of AT2G31810.2

Summary of Gene (AT2G31810.2)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G31810  TAIR      NCBI 
Gene model AT2G31810.2  
Description acetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT5G16290.2); Has 8371 Blast hits to 4290 proteins in 1102 species: Archae - 146; Bacteria - 3993; Metazoa - 0; Fungi - 172; Plants - 54; Viruses - 0; Other Eukaryotes - 4006 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 13523419-13524618)

Genome position     
from initiation codon
AT2G31810.1         
AT2G31810.3         
TSS from cDNA
TSS information
AT2G31810.2                      5'->3' (+)
Promoter sequence






 
AT2G31800.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence


 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G31810.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG10+13524223-196

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+13524221-198
TSS cloneTclone+13524224-195
TSS cloneCclone+13524225-194
TSS cloneTclone+13524227-192
TSS cloneGclone+13524240-179

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCATATATAC+1352418913524197-230-222
Y PatchTCTTCTTC+1352423113524238-188-181
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCTGACGTGT+1352407713524086-342-333
 AtREG515GCTGACGT  SA PPDB MotifACGT  PLACE MotifACGT 
 AtREG440 CTGACGTG ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG517  TGACGTGTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGTTTTGGGCTTTT+1352410813524119-311-300
 AtREG529TTTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409    GGGCTTTT PPDB MotifGCCCA  PLACE Motif 
REGTTAAAGCC+1352412113524128-298-291
 AtREG545TTAAAGCC PPDB Motif  PLACE Motif 
REGAACCGAACCGGAC+1352415113524163-268-256
 AtREG556AACCGAAC      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451 ACCGAACC     PPDB Motif  PLACE Motif 
 AtREG456  CCGAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423   CGAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579    GAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG573     AACCGGAC PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG8-13523720AT2G31800.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-13523759AT2G31800.1
TSS cloneAclone-13523723AT2G31800.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAAGTCAA-1352384113523848AT2G31800.1
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGAAAGTCAA-1352385213523859AT2G31800.1
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.