version
PlantPromoterDB promoter information of AT2G34480.1

Summary of Gene (AT2G34480.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G34480  TAIR      NCBI 
Gene model AT2G34480.1  
Description 60S ribosomal protein L18A (RPL18aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae (InterPro:IPR002670); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L18A (RPL18aC) (TAIR:AT3G14600.1); Has 545 Blast hits to 543 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 102; Plants - 93; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 14535161-14533962)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G34480.1                      5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G34480.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG166-14534201-40

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-14534206-45
TSS cloneGclone-14534201-40
TSS cloneGclone-14534200-39
TSS cloneTclone-14534199-38
TSS cloneTclone-14534198-37
TSS cloneGclone-14534197-36
TSS cloneAclone-14534196-35
TSS cloneCclone-14534189-28
TSS cloneTclone-14534179-18
TSS cloneTclone-14534177-16
TSS cloneTclone-14534175-14

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTTATAAAGA-1453422714534236-66-75
Y PatchTCTCTCTCC-1453417114534179-10-18
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTTGGGC-1453424614534253-85-92
 AtREG529TTTTGGGC PPDB MotifGCCCA  PLACE Motif 
REGAGCCCATTGGGCTTTTA-1453427814534294-117-133
 AtREG372AGCCCATT          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG551 GCCCATTG         PPDB MotifGCCCA  PLACE Motif 
 AtREG461    CATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG402     ATTGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407      TTGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376       TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409        GGGCTTTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG549         GGCTTTTA PPDB Motif  PLACE Motif 
REGTGGGCTAA-1453431314534320-152-159
 AtREG571TGGGCTAA PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.