version
PlantPromoterDB promoter information of AT2G35750.1

Summary of Gene (AT2G35750.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G35750  TAIR      NCBI 
Gene model AT2G35750.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 15031089-15029890)

Genome position     
from initiation codon
AT2G35747           
AT2G35747.1         
TSS from cDNA
TSS information
AT2G35750.1                      5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G35750.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13-15030319-230

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGTATAAATT-1503034515030353-256-264
Y PatchCTTCCTTCTC-1503032015030329-231-240
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAGGGCTT-1503037615030383-287-294
 AtREG651TAGGGCTT PPDB Motif  PLACE Motif 
REGTTAAAGGC-1503039615030403-307-314
 AtREG639TTAAAGGC PPDB MotifAAACG(C/G)  PLACE Motif 
REGAAAAGGCCCGT-1503040815030418-319-329
 AtREG459AAAAGGCC    PPDB Motif  PLACE Motif 
 AtREG359 AAAGGCCC   PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG429   AGGCCCGT PPDB MotifACGGGC  PLACE MotifGGGCC 
REGCTAATGGGCTTAATTGGGCTC-1503043415030454-345-365
 AtREG558CTAATGGG              PPDB MotifGCCCA  PLACE Motif 
 AtREG357 TAATGGGC             PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426    TGGGCTTA          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG600          TAATTGGG    PPDB MotifGCCCA  PLACE Motif 
 AtREG418           AATTGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG402            ATTGGGCT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG533             TTGGGCTC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGATGGCCCAACA-1503051415030524-425-435
 AtREG437ATGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420 TGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG449  GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG543   GCCCAACA PPDB MotifGCCCA  PLACE MotifCAACA 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.