version
PlantPromoterDB promoter information of AT2G36885

Summary of Gene (AT2G36885)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G36885  TAIR      NCBI 
Gene model AT2G36885  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 134 Blast hits to 134 proteins in 42 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 15484676-15483477)

Genome position     
from initiation codon
AT2G36885.1         
AT2G36885.2         
TSS from cDNA
TSS information
AT2G36885                        5'->3' (-)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G36885

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8-15483711-35

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-15483706-30

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTTCCC-1548372615483733-50-57
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTGTCAC-1548376315483770-87-94
 AtREG498CGTGTCACABA PPDB Motif  PLACE Motif 
REGAAAACGGCAGCGTTTTA-1548378015483796-104-120
 AtREG531AAAACGGC          PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG500 AAACGGCA         PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG626       CAGCGTTT   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG564         GCGTTTTA PPDB MotifAAACG(C/G)  PLACE Motif 
REGGTCACGTGGG-1548383115483840-155-164
 AtREG583GTCACGTG   PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG464  CACGTGGGABA, Auxin, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
REGTGTTGGGCT-1548393015483938-254-262
 AtREG543TGTTGGGC  PPDB MotifGCCCA  PLACE MotifCAACA 
 AtREG574 GTTGGGCT PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
REGTAAGGGTA-1548394915483956-273-280
 AtREG570TAAGGGTA PPDB MotifACCCT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.