version
PlantPromoterDB promoter information of AT2G36990.1

Summary of Gene (AT2G36990.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G36990  TAIR      NCBI 
Gene model AT2G36990.1  
Description Encodes a general sigma factor in chloroplasts and is probably responsible for the recognition of sigma 70 type standard bacteria-type multi-subunit RNA polymerase (PEP) promoters in young cotyledons.  
#
#

Overview

Focused view (chromosome 2: 15541016-15539817)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G36990.1                      5'->3' (-)
Promoter sequence











 
AT2G37000.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G36990.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4-15540185-169
TSS peakA4-15540093-77

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-15540139-123
TSS cloneTclone-15540138-122
TSS cloneTclone-15540134-118
TSS cloneAclone-15540093-77
TSS cloneTclone-15540092-76

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTTCTTCTTCCT-1554007115540084-55-68
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATTTGGGCTTTTAAGCCCAATATAAGGCCCAACA-1554023915540272-223-256
 AtREG421ATTTGGGC                           PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT                          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT                        PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409    GGGCTTTT                       PPDB MotifGCCCA  PLACE Motif 
 AtREG549     GGCTTTTA                      PPDB Motif  PLACE Motif 
 AtREG426           TAAGCCCA                PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT  AAGCCCAA               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402             AGCCCAAT              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355              GCCCAATA             PPDB MotifGCCCA  PLACE Motif 
 AtREG509               CCCAATAT            PPDB Motif  PLACE Motif 
 AtREG425                     ATAAGGCC      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG351                      TAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353                       AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356                        AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG449                         GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG543                          GCCCAACA PPDB MotifGCCCA  PLACE MotifCAACA 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.