version
PlantPromoterDB promoter information of AT2G37120.1

Summary of Gene (AT2G37120.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G37120  TAIR      NCBI 
Gene model AT2G37120.1  
Description DNA-binding S1FA family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: endomembrane system, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA binding protein S1FA (InterPro:IPR006779); Has 54 Blast hits to 54 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 15595815-15594616)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G37120.1                      5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G37120.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4-15594899-84

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-15594909-94
TSS cloneTclone-15594907-92

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTTCTC-1559490015594907-85-92
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTTATTGGGCTTC-1559499715595009-182-194
 AtREG611CTTATTGG      PPDB Motif  PLACE Motif 
 AtREG417 TTATTGGG     PPDB MotifGCCCA  PLACE Motif 
 AtREG355  TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG402   ATTGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407    TTGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG476     TGGGCTTC PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.