version
PlantPromoterDB promoter information of AT2G37270.1

Summary of Gene (AT2G37270.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G37270  TAIR      NCBI 
Gene model AT2G37270.1  
Description One of two genes encoding the ribosomal protein S5. Expressed at a lower level compared to ATRPS5A.  
#
#

Overview

Focused view (chromosome 2: 15650042-15648843)

Genome position     
from initiation codon
AT2G37270.2         
TSS from cDNA
TSS information
AT2G37270.1                      5'->3' (-)
Promoter sequence















 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G37270.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA146-15649218-176

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-15649218-176
TSS cloneGclone-15649217-175
TSS cloneTclone-15649210-168
TSS cloneTclone-15649203-161
TSS cloneCclone-15649200-158
TSS cloneAclone-15649196-154
TSS cloneTclone-15649189-147
TSS cloneAclone-15649171-129
TSS cloneCclone-15649150-108

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTTATAAACA-1564924215649251-200-209
Y PatchCTTCCTTCTCTTCTTCTTCTTC-1564917315649194-131-152
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAAGCCCAACATAAGCCCAATAA-1564925915649282-217-240
 AtREG409AAAAGCCC                 PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA                PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA   AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG574   AGCCCAAC              PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG543    GCCCAACA             PPDB MotifGCCCA  PLACE MotifCAACA 
 AtREG462           ATAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG426            TAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402              AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355               GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG417                CCCAATAA PPDB MotifGCCCA  PLACE Motif 
REGCCCAATAG-1564932915649336-287-294
 AtREG624CCCAATAG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.