version
PlantPromoterDB promoter information of AT2G37400.1

Summary of Gene (AT2G37400.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G37400  TAIR      NCBI 
Gene model AT2G37400.1  
Description chloroplast lumen common family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast thylakoid lumen, plastid, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT3G53560.1); Has 1554 Blast hits to 1284 proteins in 289 species: Archae - 132; Bacteria - 762; Metazoa - 103; Fungi - 19; Plants - 70; Viruses - 0; Other Eukaryotes - 468 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 15698366-15697167)

Genome position     
from initiation codon
AT2G37410.1         
AT2G37410.2         
TSS from cDNA
TSS information
AT2G37400.1                      5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G37400.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5-15698204-838
TSS peakA8-15697391-25

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTCTCTCTTT-1569737315697385-7-19
Y PatchCTTCTTCTTCCTC-1569741315697425-47-59
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAACGACGCCGT-1569746515697477-99-111
 AtREG520AAAACGAC      PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG     PPDB Motif  PLACE Motif 
 AtREG439  AACGACGC    PPDB Motif  PLACE Motif 
 AtREG537   ACGACGCC   PPDB Motif  PLACE Motif 
 AtREG540     GACGCCGT PPDB Motif  PLACE Motif 
REGTTGGGCTTATAAAGGCCCAAAT-1569748815697509-122-143
 AtREG407TTGGGCTT               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426 TGGGCTTA              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG462  GGGCTTAT             PPDB MotifGCCCA  PLACE Motif 
 AtREG467         TAAAGGCC      PPDB Motif  PLACE Motif 
 AtREG359          AAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353           AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356            AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373             GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG421              GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGCAGCGTTTTGA-1569754015697550-174-184
 AtREG626CAGCGTTT    PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG585  GCGTTTTG  PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
 AtREG653   CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.